Prev. | 

RIKEN DNA Bank Human Resource - CCDC81

Gene ID NCBI Gene 60494 |  KEGG hsa:60494
Gene Symbol CCDC81
Protein Name coiled-coil domain containing 81
Synonyms -
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162923 ARi07F03 pGCAP10 NM_021827.3  
GATTCCTCATTGGATTTTTAAGCTCTGGACTTATAAGCGCTTAACATAAACAACAACAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl