Prev. | 

RIKEN DNA Bank Human Resource - CCDC90B

Gene ID NCBI Gene 60492 |  KEGG hsa:60492
Gene Symbol CCDC90B
Protein Name coiled-coil domain containing 90B
Synonyms MDS011|MDS025
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037359 IRAK093G15 pCMV-SPORT6 BC048795 NM_021825 Full/var
HGY067346 IRAK168G02 pBluescriptR BC067764 NM_021825 Partial
HGY092407 IRAL031A07 pDNR-LIB BC014573 NM_021825 Full
HGY095127 IRAL037N15 pDNR-LIB BC020783 NM_021825 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057625 ARe44B01 pKA1U5 NM_021825.3  
ATCCTGGGAAAACTCTGAGGACATGAATAGTCGCCAGGCTTGGCGGCTCTTGCTCTCCCA
HKR057650 ARe44C02 pKA1U5 NM_021825.3  
ATCCTGGGAAAACTCTGAGGACATGAATAGTCGCCAGGCTTGGCGGCTCTTGCTCTCCCA
HKR057654 ARe44C06 pKA1U5 NM_021825.3  
GTCTCTCGGCCTTAGCGCCATTTTTTTGGAAACCTCTGCGCCATGAGAGCCAAGTGGAGG
HKR345257 RBb63C09 pGCAP1 NM_021825.3  
GGAGGACATGAATAGTCGCCAGGCTTGGCGGCTCTTGCTCTCCCAAGGCAGAGGAGATCG
HKR366551 RBd16G07 pGCAP10 NM_021825.3  
GGAGGACATGAATAGTCGCCAGGCTTGGCGGCTCTTGCTCTCCCAAGGCAGAGGAGATCG
HKR372151 RBd30G07 pGCAP10 NM_021825.3  
GGGAAAACTCTGAGGACATGAATAGTCGCCAGGCTTGGCGGCTCTTTCTCTCCCAAGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl