Prev. |  KEGG KO K15430 > 

RIKEN DNA Bank Human Resource - TRMT11

Gene ID NCBI Gene 60487 |  KEGG hsa:60487
Gene Symbol TRMT11
Protein Name tRNA methyltransferase 11 homolog
Synonyms C6orf75|MDS024|TRM11|TRMT11-1
Ortholog resource in our bank

  TRMT11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX047643 IRAK119B19 pCMV-SPORT6 BC056878 NM_021820 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095629 M01C039B05 pDONR221 MGC09-C03 BC056878 ENST00000368333  
HGE095677 M01C039D05 pDONR221 MGC09-C03 BC056878 ENST00000368333  
HGE095725 M01C039F05 pDONR221 MGC09-C03 BC056878 ENST00000368333  
HGE095773 M01C039H05 pDONR221 MGC09-C03 BC056878 ENST00000368333  
HGE095821 M01C039J05 pDONR221 MGC09-C03 BC056878 ENST00000368333  
HGE095869 M01C039L05 pDONR221 MGC09-C03 BC056878 ENST00000368333  
HGE095917 M01C039N05 pDONR221 MGC09-C03 BC056878 ENST00000368333  
HGE095965 M01C039P05 pDONR221 MGC09-C03 BC056878 ENST00000368333  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055299 ARe38E03 pKA1U5 NM_001031712.2  
GAGGCGCACGGTGGGCAGCTGCAATGGCGCTGTCGTGTACCCTTAACAGGTATCTGCTCC
HKR172122 ARi30F02 pGCAP10 NM_001031712.2  
GGCACGGTGGGCAGCTGCAATGGCGCTGTCGTGTACCCTTAACAGGTATCTGCTCCTCAT
HKR380150 RBd50G06 pGCAP10 NM_001031712.2  
GGATTCGGGGGTCTTCGCTGGTCTGCGCGGGTCACGCGTCCCCAGTCCTCGGGCGGGGTG
HKR470942 RBdS177F22 pGCAP10 NM_001031712.2  
GGGGCAGCTGCAATGGCGCTGTCGTGTACCCTTAACAGGTATCTGCTCCTCATGGCGCAG
HKR471042 RBdS177K02 pGCAP10 NM_001031712.2  
GGTGGGCAGCTGCAATGGCGCTGTCGTGTACCCTTAACAGGTATCTGCTCCTCATGGCGC
HKR471097 RBdS177M09 pGCAP10 NM_001031712.2  
GGTGGGCAGCTGCAATGGCGCTGTCGTGTACCCTTAACAGGTATCTGCTCCTCATGGCGC
HKR475031 RBdS187J15 pGCAP10 NM_001031712.2  
GGGGACCTAGCGCGGGCCGCGCAGGCGCACGGTGGGCAGCTGCAATGGCGCTGTCGTGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl