Prev. |  KEGG KO K16686 > 

RIKEN DNA Bank Human Resource - SAV1

Gene ID NCBI Gene 60485 |  KEGG hsa:60485
Gene Symbol SAV1
Protein Name salvador family WW domain containing protein 1
Synonyms SAV|WW45|WWP4
Featured content Hippo signaling (human)
Ortholog resource in our bank

  SAV1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011068 IRAK027L04 pCMV-SPORT6 BC020537 NM_021818 Full
HGY086879 IRAL017D07 pOTB7 BC006385 NM_021818 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276668 ARiS191L04 pGCAP10 NM_021818.2  
GACGGGATGTAGGCGGCGGCGGCGGTAGTGGTAGCGGTTATTCGGCGGCCCGCGGCGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl