Prev. |  KEGG KO K06111 > 

RIKEN DNA Bank Human Resource - EXOC4

Gene ID NCBI Gene 60412 |  KEGG hsa:60412
Gene Symbol EXOC4
Protein Name exocyst complex component 4
Synonyms SEC8|SEC8L1|Sec8p
Ortholog resource in our bank

  EXOC4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056465 IRAK141C17 pCMV-SPORT6 BC067263 NM_021807 Full/var
HGY094447 IRAL036B23 pDNR-LIB BC020607 NM_021807 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175251 ARi38C03 pGCAP10 NM_021807.3  
GGGAGCCTAGCGGCTCTCCCCGCGTCCAAGATGGCGGCAGAAGCAGCTGGTGGGAAATAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl