Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AVPI1

Gene ID (NCBI) 60370
Gene Symbol AVPI1
Protein Name arginine vasopressin-induced 1
Synonyms PP5395|RP11-548K23.7|VIP32|VIT32
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001968 IRAK004P08 pCMV-SPORT6 BC000877 NM_021732 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR219656 ARiS049C08 pGCAP10 NM_021732.2 done
GATACCTGGCTAGGGCCGAGGATTGGCTGTTCCGGGGCTAGGGAGCGCTTTCTCCCGGGA
HKR264548 ARiS161G04 pGCAP10 NM_021732.2 done
GGGGAACCGCGGCTGTGACCCAAGTGGCCCGGACCAGTTTGGGGCTGCGTGCGGCCTGCC
HKR383775 RBd59H07 pGCAP10 NM_021732.2 done
GGGGAACCGCGGCTGTGACCCAAGTGGCCCGGACCAGTTTGGGGCTGCGTGCGGCCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.13

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl