Prev. |  KEGG KO K18616 > 

RIKEN DNA Bank Human Resource - AFAP1

Gene ID NCBI Gene 60312 |  KEGG hsa:60312
Gene Symbol AFAP1
Protein Name actin filament associated protein 1
Synonyms AFAP|AFAP-110|AFAP110
Ortholog resource in our bank

  AFAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006121 IRAK015F01 pCMV-SPORT6 BC015900 NM_198595 Partial/var
HGX027347 IRAK068G03 pCMV-SPORT6 BC032777 NM_198595 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR190499 ARi76E03 pGCAP10 NM_198595.2  
GGTCCCGGCCGCAGCCCCACGCCGGCTGCAGCTCCGCGAGCCGAGCCGGATCTCGAGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl