Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF350

Gene ID NCBI Gene 59348 |  KEGG hsa:59348
Gene Symbol ZNF350
Protein Name zinc finger protein 350
Synonyms ZBRK1|ZFQR
Ortholog resource in our bank

  ZNF350

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083092 IRAL007M04 pOTB7 BC009921 NM_021632 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002450 W01A006C02 pENTR-TOPO flj0036l12 AK023467 NM_021632  
HGE002452 W01A006C04 pENTR-TOPO flj0036l12 AK023467 NM_021632  
HGE002454 W01A006C06 pENTR-TOPO flj0036l12 AK023467 NM_021632  
HGE044803 W01A112A03 pENTR-TOPO IRAL007M04 BC009921 NM_021632  
HGE044807 W01A112A07 pENTR-TOPO IRAL007M04 BC009921 NM_021632  
HGE044811 W01A112A11 pENTR-TOPO IRAL007M04 BC009921 NM_021632  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR014834 ARa37B10 pKA1U5 NM_021632.3  
GGGAGCAGTTTACGGAAGTGTAACGTTGAGGCCCTTCTTGTGTATCTGGAGAAAATAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl