Prev. |  KEGG KO K13113 > 

RIKEN DNA Bank Human Resource - UBL5

Gene ID NCBI Gene 59286 |  KEGG hsa:59286
Gene Symbol UBL5
Protein Name ubiquitin like 5
Synonyms HUB1
Ortholog resources KEGG ortholog (KEGG orthology K13113) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086753 IRAL016O17 pDNR-LIB BC007053 NM_024292 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050429 ARe26B05 pKA1U5 NM_024292.3  
GGGGTGAGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATTCGAGCTCCAGCTAGGATGAT
HKR056829 ARe42B05 pKA1U5 NM_024292.3  
GGCGACCGGGGTTCAGCGCTCGGGTGAGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATT
HKR172505 ARi31E09 pGCAP10 NM_024292.3  
GGTTAACTGCGACCGGGGTTCAGCGCTCGGGTGAGGAGCTGGTGGCGTCGGCAGGTTCGA
HKR208176 ARiS020H08 pGCAP10 NM_024292.3  
TGTCCGCTTCCGGTTCCTAGCGTTAACTGCGACCGGGGTTCAGCGCTCGGGTGAGGAGCT
HKR234002 ARiS085A02 pGCAP10 NM_024292.3  
GCCGGTTCCTAGCGTTAACTGCGACCGGGGTTCAGCGCTCGGGTGAGGAGCTGGTGGCGT
HKR329725 RBb24F05 pGCAP1 NM_024292.3  
GTCAGCGCTCGGGTGAGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATTCGAGCTCCAGC
HKR369630 RBd24B06 pGCAP10 NM_024292.3  
GGCGACCGGGGTTCAGCGCTCGGGTGAGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATT
HKR370574 RBd26H06 pGCAP10 NM_024292.3  
GAGCGTTAACTGCGACCGGGGTTCAGCGCTCGGGTGAGGAGCTGGTGGCGTCGGCAGGTT
HKR387284 RBd68D12 pGCAP10 NM_024292.3  
GGAGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATTCGAGCTCCAGCTAGGATGATCGAG
HKR405966 RBdS014P06 pGCAP10 NM_024292.3  
CTCGGGTGAGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATTCGAGCTCCAGCTAGGATG
HKR441887 RBdS104L23 pGCAP10 NM_024292.3  
GCCGCTTCCGGTTCCTAGCGTTAACTGCGACCGGGGTTCAGCGCTCGGGTGAGGAGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl