Prev. |  KEGG KO K17920 > 

RIKEN DNA Bank Human Resource - SNX6

Gene ID NCBI Gene 58533 |  KEGG hsa:58533
Gene Symbol SNX6
Protein Name sorting nexin 6
Synonyms MSTP010|TFAF2
Featured content Endocytosis (human)
Ortholog resource in our bank

  SNX6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082721 IRAL006N09 pOTB7 BC001798 NM_021249 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051634 ARe29B10 pKA1U5 NM_021249.3  
GGCGCCGGCCCTCGCCTCGGAGCAGCCATGATGGAAGGCCTGGACGACGGCCCGGACTTC
HKR160504 ARi01E08 pGCAP10 NM_021249.3  
GGCGCGCCTGCGCCGGCCCTCGCCTCGGAGCAGCCATGATGGAAGGCCTGGACGACGGCC
HKR260063 ARiS150C15 pGCAP10 NM_021249.3  
GGCCGGCCCTCGCCTCGGAGCANCCNTGATGGAAGGCCTGGACGACGGCCCGGACTTCCT
HKR260084 ARiS150D12 pGCAP10 NM_021249.3  
GGCCGGCCCTCGCCTCGGAGCAGCCATGATGGAAGGCCTGGACGACGGCCCGGACTTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl