Prev. | 

RIKEN DNA Bank Human Resource - ABRACL

Gene ID NCBI Gene 58527 |  KEGG hsa:58527
Gene Symbol ABRACL
Protein Name ABRA C-terminal like
Synonyms C6orf115|Costars|HSPC280|PRO2013
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093608 IRAL034A08 pOTB7 BC014953 XM_941139 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056929 ARe42F09 pKA1U5 NM_021243.2  
GGCAGATCCTGGGATCCTTGGCTCTGAGTAGCACGGTGGAAAAGTGAGCCGTCTTTCTCT
HKR074084 ARe85D12 pKA1U5 NM_021243.2  
GTCCCCCTACCCTGCTCCTCCTCCTCCACAGCCGTCTTTCTCTTTGCCTCAGCCACTTCC
HKR208061 ARiS020C13 pGCAP10 NM_021243.2  
CGGNCNGCCNATGNNCCTNGGGTGAGCTCNNCCCNGNTGCNNGGATGGCNGGGAGGGGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl