Prev. | 

RIKEN DNA Bank Human Resource - SINHCAF

Gene ID NCBI Gene 58516 |  KEGG hsa:58516
Gene Symbol SINHCAF
Protein Name SIN3-HDAC complex associated factor
Synonyms C12orf14|FAM60A|L4|TERA
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083143 IRAL007O07 pOTB7 BC000024 NM_021238 Full
HGY103378 IRAL058H10 pOTB7 BC071966 NM_021238 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR363603 RBd09A03 pGCAP10 NM_021238.1  
GATTTCAGGAGGAAGGAGCCCTTGAGGGGGACTGGCCTGGCCCGCACTCCCCNCGGACTT
HKR386126 RBd65F06 pGCAP10 NM_021238.1  
GGGGAAAGCGGAATCTACACCTTCCCGGCCAGCGGTAGCAACTGCAGAACTGCAGGAGAC
HKR386883 RBd67D11 pGCAP10 NM_021238.1  
GAAGGCAGTTGAGGAGGAGGGAGCGCTTGAGGGGGACTGGCCTGGCGTGCACTCCGCACC
HKR396499 RBd91E03 pGCAP10 NM_021238.1  
GGGGAAAGCGGAATCTACACCTTCCCGGCCAGCGGTAGCAACTGCAGAACTGCAGGAGAC
HKR433459 RBdS083K19 pGCAP10 NM_021238.1  
GAGGAGACTATCTTTCTAGACAAGGCAGTTGAGGAGGAGGGAGCGCTTGAGGGGGACTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl