Prev. | 

RIKEN DNA Bank Human Resource - SELENOK

Gene ID NCBI Gene 58515 |  KEGG hsa:58515
Gene Symbol SELENOK
Protein Name selenoprotein K
Synonyms HSPC030|HSPC297|SELK
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010705 IRAK026M17 pCMV-SPORT6 BC013162 NM_021237 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR341679 RBb54D07 pGCAP1 NM_021237.3  
GGAGATACAGAAACCGACAGGGGCCAGGCGCCCGGTGGCTCCGAAGCGGGGAAGTGGGAC
HKR348099 RBb70E03 pGCAP1 NM_021237.3  
GGGTGGCTCCGAAGCGGGGAAGTGGGACAAGATGGTTTACATCTCGAACGGACAAGTGTT
HKR382010 RBd55A10 pGCAP10 NM_021237.3  
GGGCTCCGAAGCGGGGAAGTGGGACAAGATGGTTTACATCTCGNANGGACAAGTGTTGGA
HKR420656 RBdS051K16 pGCAP10 NM_021237.3  
GACAGAAACCGACAGGGGCCAGGCGCCCGGTGGCTCCGAAGCGGGGAAGTGGGACAAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl