Prev. |  KEGG KO K21548 > 

RIKEN DNA Bank Human Resource - CREBZF

Gene ID NCBI Gene 58487 |  KEGG hsa:58487
Gene Symbol CREBZF
Protein Name CREB/ATF bZIP transcription factor
Synonyms SMILE|ZF
Ortholog resource in our bank

  CREBZF

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06263 pCMFlag_hsZF Expression vector of human ZF.

webcatalog20210331.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR337610 RBb44A10 pGCAP1 NM_001039618.1 done
GGCCTTGGCGCGGGGGGTCGACTAGCCAAGTGAGGCGGGAGGCGACTCGGACCTTTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl