RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - CREBZF

Gene ID	NCBI Gene 58487 \| KEGG hsa:58487
Gene Symbol	CREBZF
Protein Name	CREB/ATF bZIP transcription factor
Synonyms	SMILE\|ZF

Ortholog resource in our bank

  CREBZF

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB06263	pCMFlag_hsZF	Expression vector of human ZF.

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR337610	RBb44A10	pGCAP1	NM_001039618.1	No cds
HKR337610	GGCCTTGGCGCGGGGGGTCGACTAGCCAAGTGAGGCGGGAGGCGACTCGGACCTTTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl