Prev. |  KEGG KO K12272 > 

RIKEN DNA Bank Human Resource - SRPRB

Gene ID NCBI Gene 58477 |  KEGG hsa:58477
Gene Symbol SRPRB
Protein Name SRP receptor subunit beta
Synonyms APMCF1|SR-beta
Ortholog resource in our bank

  SRPRB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056228 IRAK140J12 pCMV-SPORT6 BC065299 NM_021203 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR405311 RBdS013E15 pGCAP10 NM_021203.2  
GACCACGCGTCTCATCCATGGCTTCCGCGGACTCGCGCCGGGTGGCAGATGGCGGCGGTG
HKR405537 RBdS013O01 pGCAP10 NM_021203.2  
GACCCCNCGTCTCATCCNTGGCTTCCGCGGACTCNNGCCGGGTGGCANATGGCGGCGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl