Prev. |  KEGG KO K07839 > 

RIKEN DNA Bank Human Resource - RAP2C

Gene ID NCBI Gene 57826 |  KEGG hsa:57826
Gene Symbol RAP2C
Protein Name RAP2C, member of RAS oncogene family
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K07839) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001516 IRAK003N04 pCMV-SPORT6 BC003403 NM_021183 Full/var
HGY042609 IRAK106I17 pBluescript BC051467 NM_021183 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE091607 M01C029A07 pDONR221 MGC04-A04 BC003403 NM_021183  
HGE091655 M01C029C07 pDONR221 MGC04-A04 BC003403 NM_021183  
HGE091703 M01C029E07 pDONR221 MGC04-A04 BC003403 NM_021183  
HGE091751 M01C029G07 pDONR221 MGC04-A04 BC003403 NM_021183  
HGE091799 M01C029I07 pDONR221 MGC04-A04 BC003403 NM_021183  
HGE091847 M01C029K07 pDONR221 MGC04-A04 BC003403 NM_021183  
HGE091895 M01C029M07 pDONR221 MGC04-A04 BC003403 NM_021183  
HGE091943 M01C029O07 pDONR221 MGC04-A04 BC003403 NM_021183  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR024125 ARa60F05 pKA1U5 NM_021183.3  
GAGCGGGTGGCCATGGCCTTGGCGTGACAGANCCTCCCCGGCGGCCGGGCGGGTGCGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl