Prev. |  KEGG KO K10639 > 

RIKEN DNA Bank Human Resource - CCNB1IP1

Gene ID NCBI Gene 57820 |  KEGG hsa:57820
Gene Symbol CCNB1IP1
Protein Name cyclin B1 interacting protein 1
Synonyms C14orf18|HEI10
Ortholog resources KEGG ortholog (KEGG orthology K10639) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080412 IRAL001A12 pOTB7 BC000369 NM_182852 Full
HGY083207 IRAL008A07 pOTB7 BC001218 NM_182852 Full
HGY083651 IRAL009C03 pOTB7 BC004435 NM_182852 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE029005 W01A072I13 pENTR-TOPO flj0059e03 AK026233 NM_182852  
HGE029011 W01A072I19 pENTR-TOPO flj0059e03 AK026233 NM_182852  
HGE029013 W01A072I21 pENTR-TOPO flj0059e03 AK026233 NM_182852  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336553 RBb41G09 pGCAP1 NM_021178.3  
TTCTTTCCCTCTCCGTTTTGGTGGGCTGGTTGAAGATGAAATCCACTGAGGAGGGAAGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl