Prev. |  KEGG KO K03505 > 

RIKEN DNA Bank Human Resource - POLD4

Gene ID NCBI Gene 57804 |  KEGG hsa:57804
Gene Symbol POLD4
Protein Name DNA polymerase delta 4, accessory subunit
Synonyms POLDS|p12
Featured content DNA repair (human)
Ortholog resource in our bank

  POLD4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY102999 IRAL057I07 pDNR-LIB BC070250 NM_021173

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021109 W01A052M21 pENTR-TOPO IRAL057I07 BC070250 NM_021173  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066425 ARe66B01 pKA1U5 NM_021173.2  
GGAGGCGTCCCCTCCCTGGACCCCGGCGACTTCCTCTCTCGGGGAGGAGCCCCANCCCCG
HKR081350 ARf03G06 pKA1U5 NM_021173.2  
TNNCGCCGCTGCCNGCCCGNTCTGTCTCTCTCAGCAGCTGTCTTTCTCGCGCCCACTGGC
HKR082576 ARf06H08 pKA1U5 NM_021173.2  
GCTCTCTCGGTTTGTCTGGGTCATCTTGTCTGCCCGCCGCTGGCCTGGCCCCGTCTGTCT
HKR177770 ARi44H02 pGCAP10 NM_021173.2  
GGTTTGTCTGGGTCATCTTGTCTGCCCGCCGCTGGCCTGGCCCCGTCTGTCTCTCTCAGC
HKR205577 ARiS013P17 pGCAP10 NM_021173.2  
GCCCTGGACCCCGGCGACTTCCTCTCTCGGGGAGGAGCCCCAGCCCCGCGACGAGGAGGA
HKR387630 RBd69B06 pGCAP10 NM_021173.2  
GGGCGACTTCCTCTCTCGGTTTGTCTGGGTCATCTTGTCTGCCCGCCGCTGGCCTGGCCC
HKR392099 RBd80E03 pGCAP10 NM_021173.2  
TGCTCTGAGGTGTGAGGGAGGCAGGAGGAGTGGACACGGAGGGGCCTAGAGGAGGCCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl