Prev. |  KEGG KO K09089 > 

RIKEN DNA Bank Human Resource - HES4

Gene ID NCBI Gene 57801 |  KEGG hsa:57801
Gene Symbol HES4
Protein Name hes family bHLH transcription factor 4
Synonyms bHLHb42
Ortholog resource in our bank

  HES4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091731 IRAL029F11 pOTB7 BC012351 NM_021170

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE035793 W01A089I01 pENTR-TOPO IRAL029F11 BC012351 NM_021170  
HGE035799 W01A089I07 pENTR-TOPO IRAL029F11 BC012351 NM_021170  
HGE035803 W01A089I11 pENTR-TOPO IRAL029F11 BC012351 NM_021170  
HGE035805 W01A089I13 pENTR-TOPO IRAL029F11 BC012351 NM_021170  
HGE035807 W01A089I15 pENTR-TOPO IRAL029F11 BC012351 NM_021170  
HGE035809 W01A089I17 pENTR-TOPO IRAL029F11 BC012351 NM_021170  
HGE035811 W01A089I19 pENTR-TOPO IRAL029F11 BC012351 NM_021170  
HGE035813 W01A089I21 pENTR-TOPO IRAL029F11 BC012351 NM_021170  
HGE035815 W01A089I23 pENTR-TOPO IRAL029F11 BC012351 NM_021170  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080579 ARf01H11 pKA1U5 NM_021170.3  
NNNCGTNCGNTACAGCCGGGNNCATCCGCATCNTANCGGNGNNATCNGAATCGTNNAACN
HKR338405 RBb46A05 pGCAP1 NM_021170.3  
GGGGCCTGGAGCCGGGACCCGCCCTAGGGGCTCGGATCGCCGCGCGCTCGCCGCTCGCCC
HKR376552 RBd41G08 pGCAP10 NM_021170.3  
GAGCCCNTNCGTGGTCCGTGGCGGCGCGCTCCACCCGGCACGGGGAGGCGCGGGGCGCAC
HKR406034 RBdS015B10 pGCAP10 NM_021170.3  
GGCCTGAGGCGCGCGCGGGCCTGGAGCCGGGACCCGCCCTAGGGGCTCGGATCGCCGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl