Prev. |  KEGG KO K13096 > 

RIKEN DNA Bank Human Resource - SUGP1

Gene ID NCBI Gene 57794 |  KEGG hsa:57794
Gene Symbol SUGP1
Protein Name SURP and G-patch domain containing 1
Synonyms F23858|RBP|SF4
Ortholog resource in our bank

  SUGP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056589 IRAK141H21 pCMV-SPORT6 BC063784 NM_172231 Partial
HGY080983 IRAL002H15 pOTB7 BC001043 NM_172231 Partial/var
HGY083704 IRAL009E08 pOTB7 BC002986 NM_172231 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038939 W01A097F19 pENTR-TOPO IRAK141H21 BC063784 NM_172231  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372971 RBd32H03 pGCAP10 NM_172231.2  
GGATTGGATGAGTCTCAAGATGGACAACCGGGATGTTGCAGGAAAGGCTAACCGGTGGTT
HKR432510 RBdS081E14 pGCAP10 NM_172231.2  
GATTGTGGGATTGGATGAGTCTCAAGATGGACAACCGGGATGTTGCAGGAAAGGCTAACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl