Prev. |  KEGG KO K21486 > 

RIKEN DNA Bank Human Resource - ANKRA2

Gene ID NCBI Gene 57763 |  KEGG hsa:57763
Gene Symbol ANKRA2
Protein Name ankyrin repeat family A member 2
Synonyms ANKRA
Ortholog resource in our bank

  ANKRA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011215 IRAK028A15 pCMV-SPORT6 BC012917 NM_023039 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE035393 W01A088I01 pENTR-TOPO flj0033p19 AK022876 NM_023039  
HGE035395 W01A088I03 pENTR-TOPO flj0033p19 AK022876 NM_023039  
HGE035407 W01A088I15 pENTR-TOPO flj0033p19 AK022876 NM_023039  
HGE035413 W01A088I21 pENTR-TOPO flj0033p19 AK022876 NM_023039  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR165257 ARi13C09 pGCAP10 NM_023039.3  
GGAAGCTGGCCTCAGATGGGAAGGCCCGACTCGCTGTCTGCTGTCGTCGGTGGTCGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl