Prev. | 

RIKEN DNA Bank Human Resource - SFMBT2

Gene ID NCBI Gene 57713 |  KEGG hsa:57713
Gene Symbol SFMBT2
Protein Name Scm like with four mbt domains 2
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR321225 RBb03B01 pKA1U5 NM_001029880.1  
GGCGCGAGGGAGGCGGCGGGCGGGGAGCGAGCGGGCAAGGGCGGGCGAGCGAGCAAGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl