Prev. | 

RIKEN DNA Bank Human Resource - MEAK7

Gene ID NCBI Gene 57707 |  KEGG hsa:57707
Gene Symbol MEAK7
Protein Name MTOR associated protein, eak-7 homolog
Synonyms KIAA1609|TLDC1|mEAK-7
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011657 IRAK029C09 pCMV-SPORT6 BC023251 NM_020947 Full/var
HGY053317 IRAK133E21 pBluescript BC060844 NM_020947 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091238 M01C028B14 pDONR221 MGC03-H07 BC060844 NM_020947  
HGE091286 M01C028D14 pDONR221 MGC03-H07 BC060844 NM_020947  
HGE091334 M01C028F14 pDONR221 MGC03-H07 BC060844 NM_020947  
HGE091382 M01C028H14 pDONR221 MGC03-H07 BC060844 NM_020947  
HGE091430 M01C028J14 pDONR221 MGC03-H07 BC060844 NM_020947  
HGE091478 M01C028L14 pDONR221 MGC03-H07 BC060844 NM_020947  
HGE091526 M01C028N14 pDONR221 MGC03-H07 BC060844 NM_020947  
HGE091574 M01C028P14 pDONR221 MGC03-H07 BC060844 NM_020947  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235525 ARiS088N13 pGCAP10 NM_020947.3  
GGCCCGTGGGCTGCTGGACCGGACCGGACAGCACCAGGAAGCCCGGCAGGGCTGGAGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl