Prev. |  KEGG KO K13100 > 

RIKEN DNA Bank Human Resource - CWC22

Gene ID NCBI Gene 57703 |  KEGG hsa:57703
Gene Symbol CWC22
Protein Name CWC22 spliceosome associated protein homolog
Synonyms EIF4GL|NCM|fSAPb
Ortholog resource in our bank

  CWC22

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032828 IRAK082B04 pCMV-SPORT6 BC041662 NM_020943 Partial/var
HGX046010 IRAK115A10 pCMV-SPORT6 BC053573 NM_020943 Partial/var
HGY053241 IRAK133B17 pBluescript BC057826 NM_020943 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174411 ARi36A11 pGCAP10 NM_020943.2  
GGTACGTCCGGTGTAATGGCGGCGCGGTGGAGCTCTAGGTGATGTTTGCAGACAGAAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl