Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF317

Gene ID NCBI Gene 57693 |  KEGG hsa:57693
Gene Symbol ZNF317
Protein Name zinc finger protein 317
Synonyms -
Ortholog resource in our bank

  ZNF317

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069783 IRAK174H15 pCMV-SPORT6 BC078154 NM_020933 Full/var
HGY090437 IRAL026B13 pOTB7 BC009367 NM_020933 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066803 ARe67A03 pKA1U5 NM_020933.3  
GGGAGTCGATTGCCCCGAGACACATGGGCCAAGGAGGGGTCAGCGGCGAATTCTTTCGGC
HKR368427 RBd21B03 pGCAP10 NM_020933.3  
GGGAGTCGATTGCCCCGAGACACATGGGCCAAGGAGGGGTCAGCGGCGAATTCTTTCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl