Prev. | 

RIKEN DNA Bank Human Resource - FBRSL1

Gene ID NCBI Gene 57666 |  KEGG hsa:57666
Gene Symbol FBRSL1
Protein Name fibrosin like 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388803 RBd72A03 pGCAP10 NM_001142641.1  
GAGAGCCGGCGCGGCGGACATGCGCGTCCCCGGCCCGAGCTCCGGCTGAGCAGGGCACGC
HKR442088 RBdS105D16 pGCAP10 NM_001142641.1  
GGCCGCGCCCGACGTCCGCCCGGGAGCCCAGAGCGCACCGAGCGCCGCCCAGAGCGCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl