Prev. | 

RIKEN DNA Bank Human Resource - CIP2A

Gene ID NCBI Gene 57650 |  KEGG hsa:57650
Gene Symbol CIP2A
Protein Name cellular inhibitor of PP2A
Synonyms KIAA1524|p90
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009055 IRAK022K15 pCMV-SPORT6 BC017659 NM_020890 Partial
HGX054313 IRAK135N01 pCMV-SPORT6 BC063433 NM_020890 Partial/var
HGY103617 IRAL059A17 pOTB7 BC082961 NM_020890 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR327210 RBb18A10 pKA1U5 NM_020890.2  
GGCCTCTCAGACGAGGGTGGGTTAGCGGGGGCAGCTCCCAACCCCCGTCCTGGACCCACA
HKR332009 RBb30A09 pGCAP1 NM_020890.2  
GGGGCGGTGGTGGTCCCTANGCCGGGCCGCGGCCGGTGCANNGGTACTCCACTGCCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl