Prev. |  KEGG KO K14780 > 

RIKEN DNA Bank Human Resource - DHX37

Gene ID NCBI Gene 57647 |  KEGG hsa:57647
Gene Symbol DHX37
Protein Name DEAH-box helicase 37
Synonyms DDX37|Dhr1
Ortholog resource in our bank

  DHX37

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031822 IRAK079J06 pCMV-SPORT6 BC037964 NM_032656 Full
HGY081147 IRAL002O11 pOTB7 BC009913 NM_032656 Partial
HGY081646 IRAL004B22 pOTB7 BC002575 NM_032656 Partial/var
HGY083713 IRAL009E17 pOTB7 BC009913 NM_032656 Partial
HGY103572 IRAL058P12 pOTB7 BC071824 NM_032656 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080825 M01C002B01 pDONR221 04-134-2_1-G01 BC037964 NM_032656  
HGE080873 M01C002D01 pDONR221 04-134-2_1-G01 BC037964 NM_032656  
HGE080921 M01C002F01 pDONR221 04-134-2_1-G01 BC037964 NM_032656  
HGE080969 M01C002H01 pDONR221 04-134-2_1-G01 BC037964 NM_032656  
HGE081017 M01C002J01 pDONR221 04-134-2_1-G01 BC037964 NM_032656  
HGE081065 M01C002L01 pDONR221 04-134-2_1-G01 BC037964 NM_032656  
HGE081113 M01C002N01 pDONR221 04-134-2_1-G01 BC037964 NM_032656  
HGE081161 M01C002P01 pDONR221 04-134-2_1-G01 BC037964 NM_032656  
HGE094419 M01C036A19 pDONR221 MGC07-E10 BC037964 NM_032656  
HGE094467 M01C036C19 pDONR221 MGC07-E10 BC037964 NM_032656  
HGE094515 M01C036E19 pDONR221 MGC07-E10 BC037964 NM_032656  
HGE094563 M01C036G19 pDONR221 MGC07-E10 BC037964 NM_032656  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326128 RBb15F08 pKA1U5 NM_032656.2  
ATCCTGGGGGAACCCACGCTGGGCTGGGTTTCGGATTGCTCTGCTGGTCCGGCCGCTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl