Prev. |  KEGG KO K20315 > 

RIKEN DNA Bank Human Resource - ARHGAP23

Gene ID NCBI Gene 57636 |  KEGG hsa:57636
Gene Symbol ARHGAP23
Protein Name Rho GTPase activating protein 23
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K20315) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR188174 ARi70H06 pGCAP10 NM_020876.1  
GAATCCAGCCGTCCTGCCGCCGTCCGCGCGGGCCGTCCGTCCCTTCGGGGCCCCCGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl