Prev. |  KEGG KO K12171 > 

RIKEN DNA Bank Human Resource - SH3RF1

Gene ID NCBI Gene 57630 |  KEGG hsa:57630
Gene Symbol SH3RF1
Protein Name SH3 domain containing ring finger 1
Synonyms POSH|RNF142|SH3MD2
Ortholog resource in our bank

  SH3RF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046283 IRAK115L19 pCMV-SPORT6 BC053671 NM_020870 Full/var
HGY097651 IRAL044C03 pOTB7 BC041023 NM_020870 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095611 M01C039A11 pDONR221 MGC09-A06 BC053671 NM_020870  
HGE095659 M01C039C11 pDONR221 MGC09-A06 BC053671 NM_020870  
HGE095707 M01C039E11 pDONR221 MGC09-A06 BC053671 NM_020870  
HGE095755 M01C039G11 pDONR221 MGC09-A06 BC053671 NM_020870  
HGE095803 M01C039I11 pDONR221 MGC09-A06 BC053671 NM_020870  
HGE095851 M01C039K11 pDONR221 MGC09-A06 BC053671 NM_020870  
HGE095899 M01C039M11 pDONR221 MGC09-A06 BC053671 NM_020870  
HGE095947 M01C039O11 pDONR221 MGC09-A06 BC053671 NM_020870  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076555 ARe91G11 pKA1U5 NM_020870.3  
GACTGCGAGCGGCGAGCGCGGTGGGGCCGCATCTGCATCAGCCGCCGCAGCCGCTGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl