Prev. | 

RIKEN DNA Bank Human Resource - DPP10

Gene ID NCBI Gene 57628 |  KEGG hsa:57628
Gene Symbol DPP10
Protein Name dipeptidyl peptidase like 10
Synonyms DPL2|DPPY|DPRP-3|DPRP3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013037 IRAK032J21 pBluescriptR BC030832 NM_020868 Full/var
HGY029400 IRAK073I08 pBluescriptR BC038514 NM_020868 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR360428 RBd01B04 pGCAP10 NM_001004360.2  
GTCTCCACCCCCCCGGCTGCGGTTGCCGAAGAGAGGCCGGAGCGCGGCGCCCGGCTGCTC
HKR430247 RBdS075K07 pGCAP10 NM_001004360.2  
AAAAAGAAGGCACGAGGCGTCGCCGCAGCTCGGTCAGGGGCCGGGGCCCCGCCGCTCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl