Prev. | 

RIKEN DNA Bank Human Resource - ZFAT

Gene ID NCBI Gene 57623 |  KEGG hsa:57623
Gene Symbol ZFAT
Protein Name zinc finger and AT-hook domain containing
Synonyms AITD3|ZFAT1|ZNF406
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19324 pEBMulti_HA-hZFAT Expression vector of human ZFAT tagged with HA.
RDB19325 pEGFPN1_HA-hZFAT-EGFP Expression vector of human ZFAT tagged with HA and EGFP.
RDB19326 pEGFPC3_EGFP-hZFAT Expression vector of human ZFAT tagged with EGFP.
RDB19327 pmCherryC3_mCherry-hZFAT Expression vector of human ZFAT tagged with mCherry.
RDB19328 pcDNA3_hZFAT-HA Expression vector of human ZFAT tagged with HA.
RDB19330 pcDNA3_hZFAT-HA (ZF-N delta-1) Expression vector of human ZFAT mutant (N-terminal deletion of 1-134 a.a) tagged with HA.
RDB19331 pcDNA3_hZFAT-HA (ZF-N delta-2) Expression vector of human ZFAT mutant (N-terminal deletion of 1-481 a.a) tagged with HA.
RDB19332 pcDNA3_hZFAT-HA (ZF-N delta-3) Expression vector of human ZFAT mutant (N-terminal deletion of 1-853 a.a) tagged with HA.
RDB19333 pcDNA3_hZFAT-HA (ZF-N delta-4) Expression vector of human ZFAT mutant (N-terminal deletion of 1-1064 a.a) tagged with HA.
RDB19334 pcDNA3_hZFAT-HA (ZF-C delta-1) Expression vector of human ZFAT mutant (C-terminal deletion of 271-1243 a.a) tagged with HA.
RDB19335 pcDNA3_hZFAT-HA (ZF-C delta-2) Expression vector of human ZFAT mutant (C-terminal deletion of 742-1243 a.a) tagged with HA.
RDB19336 pcDNA3_hZFAT-HA (ZF-C delta-3) Expression vector of human ZFAT mutant (C-terminal deletion of 854-1243 a.a) tagged with HA.
RDB19337 pcDNA3_hZFAT-HA (delta71-83) Expression vector of human ZFAT mutant (deletion of KRKRGRPKGSTKK) tagged with HA.
RDB19338 pcDNA3_hZFAT-HA (GRP/AAA) Expression vector of human ZFAT mutant (G75A/R76A/P77A) tagged with HA.
RDB19339 pEGFPC3_EGFP-hZFAT-HA (ZF-C delta-2) Expression vector of human ZFAT mutant (C-terminal deletion of 742-1243 a.a) tagged with EGFP and HA.
RDB19340 pEGFPC3_EGFP-hZFAT-HA (ZF-C delta-3) Expression vector of human ZFAT mutant (C-terminal deletion of 854-1243 a.a) tagged with EGFP and HA.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX017079 IRAK042L15 pCMV-SPORT6 BC039059 NM_020863 Partial
HGX042855 IRAK107C07 pCMV-SPORT6 BC046180 NM_020863 Partial
HGY095770 IRAL039H02 pOTB7 BC025423 NM_020863 Partial
HGY089886 IRAL024L22 pOTB7 BC012989 NM_001029939 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR328034 RBb20B10 pKA1U5 NM_020863.2  
GATTGAGGGAGTCCATGGATGCGGAATTAGAACCTCGCCTCAGTAAGTTGCACAGGCGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.07.13

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl