Prev. |  KEGG KO K18196 > 

RIKEN DNA Bank Human Resource - STIM2

Gene ID NCBI Gene 57620 |  KEGG hsa:57620
Gene Symbol STIM2
Protein Name stromal interaction molecule 2
Synonyms -
Ortholog resource in our bank

  STIM2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093552 IRAL033O16 pOTB7 BC015659 NM_020860 Partial
HGY099394 IRAL048I02 pDNR-LIB BC057231 NM_020860 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162879 ARi07D07 pGCAP10 NM_020860.2  
GGCCCACAGAGTGGGAGCCGGAAGCCGGGCGGGCAGCGGCGCGCGGCGTCCCGGAACCCA
HKR167230 ARi18B06 pGCAP10 NM_020860.2  
GGCCCACAGAGTGGGAGCCGGAAGCCGGGCGGGCAGCGGCGCGCGGCGTCCCGGAACCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl