Prev. |  KEGG KO K09236 > 

RIKEN DNA Bank Human Resource - TSHZ3

Gene ID NCBI Gene 57616 |  KEGG hsa:57616
Gene Symbol TSHZ3
Protein Name teashirt zinc finger homeobox 3
Synonyms TSH3|ZNF537
Ortholog resource in our bank

  TSHZ3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208177 ARiS020H09 pGCAP10 NM_020856.2  
GGCGGCGCGGGGGGGACGCGGAGAGCCTGGGCGCAGCAGCATCCTGCGGGCGGCCGCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl