Prev. |  KEGG KO K16580 > 

RIKEN DNA Bank Human Resource - SLAIN2

Gene ID NCBI Gene 57606 |  KEGG hsa:57606
Gene Symbol SLAIN2
Protein Name SLAIN motif family member 2
Synonyms KIAA1458
Ortholog resource in our bank

  SLAIN2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020887 IRAK052D15 pCMV-SPORT6 BC031691 XM_945278 Partial/var
HGY030042 IRAK075B18 pBluescriptR BC040993 XM_941571 Full
HGY086346 IRAL015O10 pOTB7 BC007701
HGY087450 IRAL018K10 pOTB7 BC006139 XM_945279 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081612 M01C004A12 pDONR221 04-134-2_2-F06 BC040993 XM_044434  
HGE081660 M01C004C12 pDONR221 04-134-2_2-F06 BC040993 XM_044434  
HGE081708 M01C004E12 pDONR221 04-134-2_2-F06 BC040993 XM_044434  
HGE081756 M01C004G12 pDONR221 04-134-2_2-F06 BC040993 XM_044434  
HGE081804 M01C004I12 pDONR221 04-134-2_2-F06 BC040993 XM_044434  
HGE081852 M01C004K12 pDONR221 04-134-2_2-F06 BC040993 XM_044434  
HGE081900 M01C004M12 pDONR221 04-134-2_2-F06 BC040993 XM_044434  
HGE081948 M01C004O12 pDONR221 04-134-2_2-F06 BC040993 XM_044434  
HGE100828 M01C052B04 pDONR221 MGC15-H02 BC040993 XM_044434  
HGE100876 M01C052D04 pDONR221 MGC15-H02 BC040993 XM_044434  
HGE100924 M01C052F04 pDONR221 MGC15-H02 BC040993 XM_044434  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060550 ARe51G06 pKA1U5 NM_020846.1  
GGGGACGGAGGGAAGATGGCGGCAGGGGCCGGATATTGGCGCCGCCTCCCCCAATCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl