Prev. | 

RIKEN DNA Bank Human Resource - WDFY1

Gene ID NCBI Gene 57590 |  KEGG hsa:57590
Gene Symbol WDFY1
Protein Name WD repeat and FYVE domain containing 1
Synonyms FENS-1|FENS1|WDF1|ZFYVE17
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056324 IRAK140N12 pCMV-SPORT6 BC065934 NM_020830 Full
HGY025462 IRAK063K22 pBluescriptR BC040525 NM_020830 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061253 ARe53C05 pKA1U5 NM_020830.3  
GGTCAGCTGATGGGCTGCCTGCCGAGGAGGCCGCAGCAGTCGCCGCGCGAACATGGCGGC
HKR064479 ARe61D07 pKA1U5 NM_020830.3  
GGTCAGCTGATGGGCTGCCTGCCGAGGAGGCCCCATNAGATCGCCGCGCGAACATGGCGG
HKR071233 ARe78B09 pKA1U5 NM_020830.3  
GGCGCGAACATGGCGGCCGAAATCCACTCCAGGCCGCAGAGCAGCCGCCCGGTGCTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl