Prev. |  KEGG KO K15429 > 

RIKEN DNA Bank Human Resource - TRMT5

Gene ID NCBI Gene 57570 |  KEGG hsa:57570
Gene Symbol TRMT5
Protein Name tRNA methyltransferase 5
Synonyms COXPD26|KIAA1393|TRM5
Ortholog resource in our bank

  TRMT5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176476 ARi41D04 pGCAP10 NM_020810.2  
GGCCCATCCACCCGCGACCCACATCCGATCGGTACCGGAGCGGGAGGTGAGGGGTCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl