Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NCEH1

Gene ID (NCBI) 57552
Gene Symbol NCEH1
Protein Name neutral cholesterol ester hydrolase 1
Synonyms AADACL1|NCEH
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY018544 IRAK046F24 pBluescriptR BC028734 NM_020792 Full/var
HGY036304 IRAK090M16 pBluescript BC047588 NM_020792 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE086009 M01C015A09 pDONR221 FLJ05-A05 BC047588 NM_020792
HGE086057 M01C015C09 pDONR221 FLJ05-A05 BC047588 NM_020792
HGE086105 M01C015E09 pDONR221 FLJ05-A05 BC047588 NM_020792
HGE086153 M01C015G09 pDONR221 FLJ05-A05 BC047588 NM_020792
HGE086201 M01C015I09 pDONR221 FLJ05-A05 BC047588 NM_020792
HGE086249 M01C015K09 pDONR221 FLJ05-A05 BC047588 NM_020792

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR042952 ARe07G08 pKA1U5 NM_020792.3
TTGGGGGCAGAAAGTTGCCGGAGGTCTCCGGGCTGGTATCGCCCTTTCCTCTTTGCCAGC
HKR165727 ARi14F07 pGCAP10 NM_020792.3
GGCGGGCAGAAAGTTGCCGGAGGTCTCCGGGTGGTATCGCCCTTTCCTCTTTGCCAGCCC
HKR247375 ARiS118H07 pGCAP10 NM_020792.3
GGGGCAGAAAGTTGCCGGAGGTCTCCGGGTGGTATCGCCCTTTCCTCTTTGCCAGCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.08

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl