Prev. | 

RIKEN DNA Bank Human Resource - IGSF9

Gene ID NCBI Gene 57549 |  KEGG hsa:57549
Gene Symbol IGSF9
Protein Name immunoglobulin superfamily member 9
Synonyms FP18798|IGSF9A|Nrt1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092360 IRAL030O24 pOTB7 BC030141 NM_020789

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100426 M01C051B02 pDONR221 MGC15-D01 BC030141 ENST00000368095  
HGE100474 M01C051D02 pDONR221 MGC15-D01 BC030141 ENST00000368095  
HGE100522 M01C051F02 pDONR221 MGC15-D01 BC030141 ENST00000368095  
HGE100570 M01C051H02 pDONR221 MGC15-D01 BC030141 ENST00000368095  
HGE100618 M01C051J02 pDONR221 MGC15-D01 BC030141 ENST00000368095  
HGE100666 M01C051L02 pDONR221 MGC15-D01 BC030141 ENST00000368095  
HGE100714 M01C051N02 pDONR221 MGC15-D01 BC030141 ENST00000368095  
HGE100762 M01C051P02 pDONR221 MGC15-D01 BC030141 ENST00000368095  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348077 RBb70D05 pGCAP1 NM_020789.3  
GGAGGCGGGTCCGCCCCCTATTGTGTAGCGGCGAGAGTGGAGCCGAGCGGTGCGGAGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl