Prev. | 

RIKEN DNA Bank Human Resource - DISP3

Gene ID NCBI Gene 57540 |  KEGG hsa:57540
Gene Symbol DISP3
Protein Name dispatched RND transporter family member 3
Synonyms PTCHD2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR369703 RBd24E07 pGCAP10 NM_020780.1 full cds done
GGGGTTGCGAGCTGAGGACTGGGATTCGCGCGCAGCTTCCCGCGGTCTGCTTGCCCTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl