Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUFIP2

Gene ID (NCBI) 57532
Gene Symbol NUFIP2
Protein Name NUFIP2, FMR1 interacting protein 2
Synonyms 182-FIP|82-FIP|FIP-82|PIG1
Databases KEGG hsa:57532 |  NCBI Gene 57532


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046151 ARe15G07 pKA1U5 NM_020772.2  
AGATCCTGACGGTGCAGCAGCCCGCAGCCTCAGCCNTGGAGTCCCAGCCGCTTTCAATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl