Prev. |  KEGG KO K16355 > 

RIKEN DNA Bank Human Resource - LRFN2

Gene ID NCBI Gene 57497 |  KEGG hsa:57497
Gene Symbol LRFN2
Protein Name leucine rich repeat and fibronectin type III domain containing 2
Synonyms FIGLER2|KIAA1246|SALM1
Ortholog resource in our bank

  LRFN2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405646 RBdS014B22 pGCAP10 NM_020737.3 Full/var done
GGAGACACACATACACTCACACATACACAACCCGGCAGGCTCGTCTGAACTTGAAGACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl