Prev. | 

RIKEN DNA Bank Human Resource - MIF4GD

Gene ID NCBI Gene 57409 |  KEGG hsa:57409
Gene Symbol MIF4GD
Protein Name MIF4G domain containing
Synonyms AD023|MIFD|SLIP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027560 IRAK068O24 pCMV-SPORT6 BC033759 NM_020679 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094023 M01C035A23 pDONR221 MGC07-A12 BC033759 NM_020679  
HGE094071 M01C035C23 pDONR221 MGC07-A12 BC033759 NM_020679  
HGE094119 M01C035E23 pDONR221 MGC07-A12 BC033759 NM_020679  
HGE094167 M01C035G23 pDONR221 MGC07-A12 BC033759 NM_020679  
HGE094215 M01C035I23 pDONR221 MGC07-A12 BC033759 NM_020679  
HGE094263 M01C035K23 pDONR221 MGC07-A12 BC033759 NM_020679  
HGE094311 M01C035M23 pDONR221 MGC07-A12 BC033759 NM_020679  
HGE094359 M01C035O23 pDONR221 MGC07-A12 BC033759 NM_020679  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218013 ARiS045A13 pGCAP10 NM_020679.2  
GGGCGCCGAGCGGCCCCGGGCACGCGCGCGCGCCACCGGCCCGGCAGGTGCTGTCCTTAT
HKR378972 RBd47H04 pGCAP10 NM_020679.2  
GCCCCGGCGCCGCGCGAGGAGATGAGCTCACGGCGGGCCCCGCAGCGCCGGACGCTGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl