Prev. | 

RIKEN DNA Bank Human Resource - NMRAL1

Gene ID NCBI Gene 57407 |  KEGG hsa:57407
Gene Symbol NMRAL1
Protein Name NmrA like redox sensor 1
Synonyms HSCARG|SDR48A1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086202 IRAL015I10 pOTB7 BC002927 NM_020677 Full
HGY089869 IRAL024L05 pOTB7 BC007364 NM_020677 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR192460 ARi81C12 pGCAP10 NM_020677.2  
GCCCTTGTTCCTGACACGCCCTTGCCGGGGGCGGGAAGCGGGGTATGTGGGTTTCCCCAA
HKR452847 RBdS132B23 pGCAP10 NM_020677.2  
GGTCCTCCGACGCTGGGCTTCCGTGAGCGGCGCTCTGCCAGGTGGGGCCGGAGCTGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl