Prev. |  KEGG KO K07891 > 

RIKEN DNA Bank Human Resource - RAB22A

Gene ID NCBI Gene 57403 |  KEGG hsa:57403
Gene Symbol RAB22A
Protein Name RAB22A, member RAS oncogene family
Synonyms -
Featured content Endocytosis (human)
Featured content Rab Family - human
Ortholog resource in our bank

  RAB22A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006054 IRAK015C06 pCMV-SPORT6 BC015710 NM_020673 Full
HGY086578 IRAL016H10 pDNR-LIB BC007036 NM_020673 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR243794 ARiS109I02 pGCAP10 NM_020673.2  
GGACGCGGCCGGCGTCCCAAGATGGCGGCGGCGGCGGCTCCCGGAAGGCCGCGGCGGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl