Prev. |  KEGG KO K16075 > 

RIKEN DNA Bank Human Resource - MRS2

Gene ID NCBI Gene 57380 |  KEGG hsa:57380
Gene Symbol MRS2
Protein Name magnesium transporter MRS2
Synonyms HPT|MRS2L
Ortholog resource in our bank

  MRS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY101954 IRAL054O18 pOTB7 BC069009 NM_020662 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR384902 RBd62E06 pGCAP10 NM_020662.2  
GACAGAGTCTGCAGGTCGGGCGGTAGCGACAGGTCAGAGCTGCGGCCTGAGCAGCCAGCG
HKR398908 RBd97E12 pGCAP10 NM_020662.2  
GGGTGCACAGAGTCTGCAGGTCGGGCGGTAGCGACAGGTCAGAGCTGCGGCCTGAGCAGC
HKR409120 RBdS022N08 pGCAP10 NM_020662.2  
GAGAGCTGCGGCCTGAGCAGCCAGCGTCCGGCATGAAGGTCTGGGGTCTGGCTGCTGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl