Prev. | 

RIKEN DNA Bank Human Resource - KAT14

Gene ID NCBI Gene 57325 |  KEGG hsa:57325
Gene Symbol KAT14
Protein Name lysine acetyltransferase 14
Synonyms ATAC2|CRP2BP|CSRP2BP|PRO1194|dJ717M23.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085814 IRAL014I22 pOTB7 BC009174 NM_177926 Full
HGY089128 IRAL022N16 pOTB7 BC007537 NM_177926 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR386527 RBd66F07 pGCAP10 NM_020536.2  
GAGGGGTCGAGCCTGGGCAGTACAGGCGGCGGTGCGCACTCTGCGGCGGCCTCTGCGCCT
HKR388006 RBd70A06 pGCAP10 NM_020536.2  
GGCGCCTCGGGCGGGCGGGAGAGAGAGGCCGCGGCCGCCAGCGTGGGGATGTCTAGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl