Prev. |  KEGG KO K17926 > 

RIKEN DNA Bank Human Resource - SNX14

Gene ID NCBI Gene 57231 |  KEGG hsa:57231
Gene Symbol SNX14
Protein Name sorting nexin 14
Synonyms RGS-PX2|SCAR20
Ortholog resource in our bank

  SNX14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066873 IRAK167D01 pBluescriptR BC068589 NM_153816 Full/var
HGY036406 IRAK091A06 pBluescript BC046520 NM_153816 Partial/var
HGY087511 IRAL018M23 pOTB7 BC005110 NM_020468 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE043674 W01A109D02 pENTR-TOPO IRAL018M23 BC005110 NM_020468  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178106 ARi45E10 pGCAP10 NM_153816.3  
GGTGTGTGCGCCGCCAAGTCGGTGGGGCGGGGACGCGAGGTGTGGATGGGGGGTCGCCTT
HKR334907 RBb37E11 pGCAP1 NM_153816.3  
GGTCTGTGTGCGCCGCCAAGTCGGTGGGGCGGGGACGCGAGGTGTGGATGGGGGGTCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl