Prev. | 

RIKEN DNA Bank Human Resource - SMAGP

Gene ID NCBI Gene 57228 |  KEGG hsa:57228
Gene Symbol SMAGP
Protein Name small cell adhesion glycoprotein
Synonyms hSMAGP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001327 IRAK003F07 pCMV-SPORT6 BC003379 NM_001033873 Partial
HGY029870 IRAK074L06 pBluescriptR BC045658 NM_001033873 Full
HGY081955 IRAL004O19 pOTB7 BC001400 NM_001033873 Partial
HGY089536 IRAL023N24 pOTB7 BC008712 NM_001033873

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074835 ARe87B11 pKA1U5 NM_001031628.1  
GCTCTGCTGGCCTCCGCGACTCCGCGGTGCCCGCCCCCGNTTGAGTTCAAAAGGACGCGC
HKR203485 ARiS008L21 pGCAP10 NM_001031628.1  
GGAGTCAAGAGGTAGCTAAAGCATGGCACTGATTATTCAAATTGAGGTGCTCACCATGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl