Prev. |  KEGG KO K17491 > 

RIKEN DNA Bank Human Resource - PPP4R3B

Gene ID NCBI Gene 57223 |  KEGG hsa:57223
Gene Symbol PPP4R3B
Protein Name protein phosphatase 4 regulatory subunit 3B
Synonyms FLFL2|PP4R3B|PSY2|SMEK2|smk1
Ortholog resource in our bank

  PPP4R3B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053470 IRAK133L06 pBluescript BC060855 NM_020463
HGY081766 IRAL004G22 pOTB7 BC006215 NM_020463 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091224 M01C028A24 pDONR221 MGC03-F12 BC060855 NM_020463  
HGE091272 M01C028C24 pDONR221 MGC03-F12 BC060855 NM_020463  
HGE091320 M01C028E24 pDONR221 MGC03-F12 BC060855 NM_020463  
HGE091368 M01C028G24 pDONR221 MGC03-F12 BC060855 NM_020463  
HGE091416 M01C028I24 pDONR221 MGC03-F12 BC060855 NM_020463  
HGE091464 M01C028K24 pDONR221 MGC03-F12 BC060855 NM_020463  
HGE091512 M01C028M24 pDONR221 MGC03-F12 BC060855 NM_020463  
HGE091560 M01C028O24 pDONR221 MGC03-F12 BC060855 NM_020463  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR189703 ARi74E07 pGCAP10 NM_020463.2  
GAGAAAGGCAGAGAGAGTCGGGTTACAAGATGGCGGATCTGTAGTAGTTACCGCGGCGGC
HKR386829 RBd67B05 pGCAP10 NM_020463.2  
GAGAGAGANTCGGGTTACAAGATGGCGGATCTGTAGTAGTTACCGCGGCGGCGGGAGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl